An Astronauts Guide To Life On Earth Download Ebook PDF Epub Online

Author : Chris Hadfield
Publisher : Back Bay Books
Release : 2015-04-14
Page : 320
Category : Business & Economics
ISBN 13 : 9780316253031
Description :


"Hadfield is a genius, a man of science and technology and no first-timer to the universe."-New York Post Chris Hadfield has spent decades training as an astronaut and has logged nearly 4000 hours in space. During this time he has broken into a Space Station with a Swiss army knife, disposed of a live snake while piloting a plane, and been temporarily blinded while clinging to the exterior of an orbiting spacecraft. In his bestselling An Astronaut's Guide to Life on Earth, Hadfield takes readers deep into his years of training and space exploration to show how to make the impossible possible. Through eye-opening, entertaining stories, his vivid and refreshing insights will teach you how to think like an astronaut, and will change, completely, the way you view life on Earth-especially your own.


Author : Chris Hadfield
Publisher :
Release : 2013
Page : 336
Category : Science
ISBN 13 : 9781447257516
Description :


Colonel Chris Hadfield has spent decades training as an astronaut and has logged nearly 4,000 hours in space. During this time he has broken into a Space Station with a Swiss army knife, disposed of a live snake while piloting a plane, and been temporarily blinded while clinging to the exterior of an orbiting spacecraft. The secret to Col. Hadfield's success - and survival - is an unconventional philosophy he learned at NASA: prepare for the worst - and enjoy every moment of it. In An Astronaut's Guide to Life on Earth, Col. Hadfield takes readers deep into his years of training and space exploration to show how to make the impossible possible. Through eye-opening, entertaining stories filled with the adrenaline of launch, the mesmerizing wonder of spacewalks and the measured, calm responses mandated by crises, he explains how conventional wisdom can get in the way of achievement - and happiness. His own extraordinary education in space has taught him some counterintuitive lessons: don't visualize success, do care what others think, and always sweat the small stuff. You might never be able to build a robot, pilot a spacecraft, make a music video or perform basic surgery in zero gravity like Col. Hadfield. But his vivid and refreshing insights will teach you how to think like an astronaut, and will change, completely, the way you view life on Earth - especially your own.


Author : Chris Hadfield
Publisher : Little, Brown
Release : 2013-10-29
Page : 304
Category : Business & Economics
ISBN 13 : 0316253049
Description :


Colonel Chris Hadfield has spent decades training as an astronaut and has logged nearly 4000 hours in space. During this time he has broken into a Space Station with a Swiss army knife, disposed of a live snake while piloting a plane, and been temporarily blinded while clinging to the exterior of an orbiting spacecraft. The secret to Col. Hadfield's success-and survival-is an unconventional philosophy he learned at NASA: prepare for the worst- and enjoy every moment of it. In An Astronaut's Guide to Life on Earth, Col. Hadfield takes readers deep into his years of training and space exploration to show how to make the impossible possible. Through eye-opening, entertaining stories filled with the adrenaline of launch, the mesmerizing wonder of spacewalks, and the measured, calm responses mandated by crises, he explains how conventional wisdom can get in the way of achievement-and happiness. His own extraordinary education in space has taught him some counterintuitive lessons: don't visualize success, do care what others think, and always sweat the small stuff. You might never be able to build a robot, pilot a spacecraft, make a music video or perform basic surgery in zero gravity like Col. Hadfield. But his vivid and refreshing insights will teach you how to think like an astronaut, and will change, completely, the way you view life on Earth-especially your own.


Author : Chris Hadfield
Publisher : Pan Macmillan
Release : 2014-10-14
Page :
Category : Photography
ISBN 13 : 1447278615
Description :


In You Are Here, celebrated astronaut Chris Hadfield gives us the really big picture: this is our home, as seen from space. The millions of us who followed Hadfield's news-making Twitter feed from the International Space Station thought we knew what we were looking at when we first saw his photos. But we may have caught the beauty and missed the full meaning. Now, through photographs – many of which have never been shared – Hadfield unveils a fresh and insightful look at our planet. He sees astonishing detail and importance in these images, not just because he's spent months in space but because his in-depth knowledge of geology, geography and meteorology allows him to reveal the photos' mysteries. Featuring Hadfield's favourite images, You Are Here is divided by continent and represents one (idealized) orbit of the ISS. Surprising, thought-provoking and visually delightful, it opens a singular window on our planet, using remarkable photographs to illuminate the history and consequences of human settlement, the magnificence of never-before-noticed landscapes, and the power of the natural forces shaping our world and the future of our species.


Author : Chris Hadfield
Kate Fillion
Publisher : Tundra Books
Release : 2016-09-10
Page : 40
Category : Juvenile Fiction
ISBN 13 : 1101918640
Description :


Inspired by the childhood of real-life astronaut Chris Hadfield and brought to life by Terry and Eric Fan's lush, evocative illustrations, The Darkest Dark will encourage readers to dream the impossible. Chris loves rockets and planets and pretending he's a brave astronaut, exploring the universe. Only one problem--at night, Chris doesn't feel so brave. He's afraid of the dark. But when he watches the groundbreaking moon landing on TV, he realizes that space is the darkest dark there is--and the dark is beautiful and exciting, especially when you have big dreams to keep you company.


Author : Terry Virts
Publisher : Workman Publishing
Release : 2020-09-15
Page : 320
Category : Science
ISBN 13 : 1523512040
Description :


"There's something intriguing to be learned on practically every page... [How to Astronaut] captures the details of an extraordinary job and turns even the mundane aspects of space travel into something fascinating."––Publishers Weekly Ride shotgun on a trip to space with astronaut Terry Virts. A born stroyteller with a gift for the surprising turn of phrase and eye for the perfect you-are-there details, he captures all the highs, lows, humor, and wonder of an experience few will ever know firsthand. Featuring stories covering survival training, space shuttle emergencies, bad bosses, the art of putting on a spacesuit, time travel, and much more!


Author : Tim Peake
Publisher : Little, Brown
Release : 2017-10-17
Page : 8
Category : Biography & Autobiography
ISBN 13 : 031651280X
Description :


Was it fun to do a space walk? How squashed were you in the capsule on the way back? What were your feelings as you looked down on Earth for the first time? Were you ever scared? Where to next -- the Moon, Mars, or beyond? Based on his historic mission to the International Space Station, Ask an Astronaut is Tim Peake's guide to life in space, and his answers to the thousands of questions he has been asked since his return to Earth. With explanations ranging from the mundane -- how do you wash your clothes or go to the bathroom while in orbit? -- to the profound -- what's the point? -- all written in Tim's characteristically warm style, Tim shares his thoughts on every aspect of space exploration. From training for the mission to launch, to his historic spacewalk, to re-entry, he reveals for readers of all ages the cutting-edge science behind his groundbreaking experiments, and the wonders of daily life on board the International Space Station. The public was invited to submit questions using the hashtag #askanastronaut, and a selection are answered by Tim in the book, accompanied with illustrations, diagrams, and never-before-seen photos.


Author : Mike Massimino
Publisher : Crown Archetype
Release : 2016-10-04
Page : 336
Category : Biography & Autobiography
ISBN 13 : 1101903554
Description :


NEW YORK TIMES BESTSELLER • Have you ever wondered what it would be like to find yourself strapped to a giant rocket that’s about to go from zero to 17,500 miles per hour? Or to look back on Earth from outer space and see the surprisingly precise line between day and night? Or to stand in front of the Hubble Space Telescope, wondering if the emergency repair you’re about to make will inadvertently ruin humankind’s chance to unlock the universe’s secrets? Mike Massimino has been there, and in Spaceman he puts you inside the suit, with all the zip and buoyancy of life in microgravity. Massimino’s childhood space dreams were born the day Neil Armstrong set foot on the moon. Growing up in a working-class Long Island family, he catapulted himself to Columbia and then MIT, only to flunk his first doctoral exam and be rejected three times by NASA before making it through the final round of astronaut selection. Taking us through the surreal wonder and beauty of his first spacewalk, the tragedy of losing friends in the Columbia shuttle accident, and the development of his enduring love for the Hubble Telescope—which he and his fellow astronauts were tasked with saving on his final mission—Massimino has written an ode to never giving up and the power of teamwork to make anything possible. Spaceman invites us into a rare, wonderful world where science meets the most thrilling adventure, revealing just what having “the right stuff” really means.


Author : Scott Kelly
Publisher : Vintage
Release : 2017-10-17
Page : 400
Category : Biography & Autobiography
ISBN 13 : 1524731609
Description :


NATIONAL BEST SELLER A stunning, personal memoir from the astronaut and modern-day hero who spent a record-breaking year aboard the International Space Station—a message of hope for the future that will inspire for generations to come. The veteran of four spaceflights and the American record holder for consecutive days spent in space, Scott Kelly has experienced things very few have. Now, he takes us inside a sphere utterly hostile to human life. He describes navigating the extreme challenge of long-term spaceflight, both life-threatening and mundane: the devastating effects on the body; the isolation from everyone he loves and the comforts of Earth; the catastrophic risks of colliding with space junk; and the still more haunting threat of being unable to help should tragedy strike at home--an agonizing situation Kelly faced when, on a previous mission, his twin brother's wife, American Congresswoman Gabrielle Giffords, was shot while he still had two months in space. Kelly's humanity, compassion, humor, and determination resonate throughout, as he recalls his rough-and-tumble New Jersey childhood and the youthful inspiration that sparked his astounding career, and as he makes clear his belief that Mars will be the next, ultimately challenging, step in spaceflight. In Endurance, we see the triumph of the human imagination, the strength of the human will, and the infinite wonder of the galaxy.


Author : Alyssa Carson
Publisher :
Release : 2018-11-28
Page : 44
Category :
ISBN 13 : 9781731357946
Description :


A realistic guide to becoming an Astronaut at a young age.


Author : Andrew Langley
Publisher : Capstone
Release : 2015-08
Page : 48
Category : Juvenile Nonfiction
ISBN 13 : 1484625226
Description :


Join Chris Hadfield living on the International Space Station! This book examines the extraordinary life of one of the most popular astronauts, from his early life to the six months he spent living in space. Discover what the International Space Centre is used for, and how astronauts like Hadfield can live there. Find out about the rigorous training that astronauts undergo and how they prepare for a journey into the unknown.


Author : Adam Rutherford
Publisher : Penguin UK
Release : 2013-04-04
Page : 272
Category : Science
ISBN 13 : 0141970227
Description :


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG


Author : Milkyway Media
Publisher : Milkyway Media
Release : 2018-08-31
Page : 29
Category : Study Aids
ISBN 13 :
Description :


An Astronaut’s Guide to Life on Earth: What Going to Space Taught Me About Ingenuity, Determination, and Being Prepared for Anything (2013) by Chris Hadfield tells the Canadian astronaut’s life story and offers practical life advice based on this professional experience. Focusing on his training and his third and final mission to space, Hadfield demonstrates how the unusual way in which astronauts work is surprisingly applicable to everyday life… Purchase this in-depth summary to learn more.


Author : Caleb Scharf
Publisher : Scientific American / Farrar, Straus and Giroux
Release : 2014-09-09
Page : 288
Category : Science
ISBN 13 : 0374709467
Description :


Longlisted for the 2015 PEN/E.O. Wilson Literary Science Writing Award Short-listed for Physics World's Book of the Year The Sunday Times (UK) Best Science Book of 2014 A Publishers Weekly Top 10 Science Book of Fall 2014 An NBC News Top Science and Tech Book of 2014 A Politics & Prose 2014 Staff Pick In the sixteenth century, Nicolaus Copernicus dared to go against the establishment by proposing that Earth rotates around the Sun. Having demoted Earth from its unique position in the cosmos to one of mediocrity, Copernicus set in motion a revolution in scientific thought. This perspective has influenced our thinking for centuries. However, recent evidence challenges the Copernican Principle, hinting that we do in fact live in a special place, at a special time, as the product of a chain of unlikely events. But can we be significant if the Sun is still just one of a billion trillion stars in the observable universe? And what if our universe is just one of a multitude of others-a single slice of an infinity of parallel realities? In The Copernicus Complex, the renowned astrophysicist Caleb Scharf takes us on a scientific adventure, from tiny microbes within the Earth to distant exoplanets, probability theory, and beyond, arguing that there is a solution to this contradiction, a third way of viewing our place in the cosmos, if we weigh the evidence properly. As Scharf explains, we do occupy an unusual time in a 14-billion-year-old universe, in a somewhat unusual type of solar system surrounded by an ocean of unimaginable planetary diversity: hot Jupiters with orbits of less than a day, planet-size rocks spinning around dead stars, and a wealth of alien super-Earths. Yet life here is built from the most common chemistry in the universe, and we are a snapshot taken from billions of years of biological evolution. Bringing us to the cutting edge of scientific discovery, Scharf shows how the answers to fundamental questions of existence will come from embracing the peculiarity of our circumstance without denying the Copernican vision. With characteristic verve, Scharf uses the latest scientific findings to reconsider where we stand in the balance between cosmic significance and mediocrity, order and chaos. Presenting a compelling and bold view of our true status, The Copernicus Complex proposes a way forward in the ultimate quest: determining life's abundance, not just across this universe but across all realities.


Author : Deborah Rose
Publisher : Persnickety Press
Release : 2020-09-05
Page : 36
Category :
ISBN 13 : 9781943978502
Description :


Zoom around Earth from A to Z with astronauts on the International Space Station in Astronauts Zoom! "You are there" photos and fun, fact-filled text give young readers and listeners a space-eye view of astronauts in action in this out-of-this-world alphabet book.


Author : Tom Wolfe
Publisher : Farrar, Straus and Giroux
Release : 2008-03-04
Page : 448
Category : History
ISBN 13 : 9781429961325
Description :


From "America's nerviest journalist" (Newsweek)--a breath-taking epic, a magnificent adventure story, and an investigation into the true heroism and courage of the first Americans to conquer space. "Tom Wolfe at his very best" (The New York Times Book Review) Millions of words have poured forth about man's trip to the moon, but until now few people have had a sense of the most engrossing side of the adventure; namely, what went on in the minds of the astronauts themselves - in space, on the moon, and even during certain odysseys on earth. It is this, the inner life of the astronauts, that Tom Wolfe describes with his almost uncanny empathetic powers, that made The Right Stuff a classic.


Author : Dave Williams
Publisher : Simon & Schuster
Release : 2019-10-01
Page : 240
Category : Biography & Autobiography
ISBN 13 : 1501160974
Description :


INSTANT NATIONAL BESTSELLER An inspirational, uplifting, and life-affirming memoir about passion, resilience, and living life to the fullest, from Dr. Dave Williams, one of Canada’s most accomplished astronauts. I had dreamt about becoming an astronaut from the time I watched Alan Shepard launch on the first American sub-orbital flight on May 5, 1961. Eleven days before my seventh birthday, I committed to a new goal: one day, I would fly in outer space. Dr. Dave has led the sort of life that most people only dream of. He has set records for spacewalking. He has lived undersea for weeks at a time. He has saved lives as an emergency doctor, launched into the stratosphere twice, and performed surgery in zero gravity. But if you ask him how he became so accomplished, he’ll say: “I’m just a curious kid from Saskatchewan.” Curious indeed. Dr. Dave never lost his desire to explore nor his fascination with the world. Whether he was exploring the woods behind his childhood home or floating in space at the end of the Canadarm, Dave tried to see every moment of his life as filled with beauty and meaning. He learned to scuba dive at only twelve years old, became a doctor despite academic struggles as an undergraduate, and overcame stiff odds and fierce competition to join the ranks of the astronauts he had idolized as a child. There were setbacks and challenges along the way—the loss of friends in the Columbia disaster, a cancer diagnosis that nearly prevented him from returning to space—but through it all, Dave never lost sight of his goal. And when he finally had the chance to fly among the stars, he came to realize that although the destination can be spectacular, it’s the journey that truly matters. In Defying Limits, Dave shares the events that have defined his life, showing us that whether we’re gravity-defying astronauts or earth-bound terrestrials, we can all live an infinite, fulfilled life by relishing the value and importance of each moment. The greatest fear that we all face is not the fear of dying, but the fear of never having lived. Each of us is greater than we believe. And, together, we can exceed our limits to soar farther and higher than we ever imagined.


Author : Jeannie Vanasco
Publisher : Tin House Books
Release : 2019-10-01
Page : 360
Category : Biography & Autobiography
ISBN 13 : 1947793543
Description :


A New York Times Editors’ Choice and Best Book of the Year at TIME, Esquire, Amazon, Kirkus, and Electric Literature Jeannie Vanasco has had the same nightmare since she was a teenager. It is always about him: one of her closest high school friends, a boy named Mark. A boy who raped her. When her nightmares worsen, Jeannie decides—after fourteen years of silence—to reach out to Mark. He agrees to talk on the record and meet in person. Jeannie details her friendship with Mark before and after the assault, asking the brave and urgent question: Is it possible for a good person to commit a terrible act? Jeannie interviews Mark, exploring how rape has impacted his life as well as her own. Unflinching and courageous, Things We Didn’t Talk About When I Was a Girl is part memoir, part true crime record, and part testament to the strength of female friendships—a recounting and reckoning that will inspire us to ask harder questions, push towards deeper understanding, and continue a necessary and long overdue conversation.


Author : Mario Livio
Publisher : Simon and Schuster
Release : 2014-05-27
Page : 352
Category : Biography & Autobiography
ISBN 13 : 1439192375
Description :


We all make mistakes. Nobody is perfect. And that includes five of the greatest scientists in history -- Charles Darwin, William Thomson (Lord Kelvin), Linus Pauling, Fred Hoyle, Albert Einstein. But the mistakes that these great scientists made helped science to advance. Indeed, as Mario Livio explains in this fascinating book, science thrives on error; it advances when erroneous ideas are disproven. All five scientists were great geniuses and fascinating human beings. Their blunders were part of their genius and part of the scientific process. Livio brilliantly analyses their errors to show where they were wrong and right, but what makes his book so enjoyable to read is Livio's analysis of the psychology of these towering figures. Along the way the reader learns an enormous amount about the evolution of life on earth and in the universe, but from an unusual vantage point -- the mistakes of great scientists rather than the achievements that made them famous.


Author : Milkyway Media
Publisher :
Release : 2018-01-27
Page : 26
Category :
ISBN 13 : 9781977015013
Description :


An Astronaut's Guide to Life on Earth: What Going to Space Taught Me About Ingenuity, Determination, and Being Prepared for Anything (2013) by Chris Hadfield tells the Canadian astronaut's life story and offers practical life advice based on this professional experience. Focusing on his training and his third and final mission to space, Hadfield demonstrates how the unusual way in which astronauts work is surprisingly applicable to everyday life...Purchase this in-depth analysis to learn more.